Characterisation of Prostate Cancer Stem Cells

Characterisation of prostatic gland gland Cancer Stem CellsAbstractBackgroundAdvances in the study of crabmeat electric cadres with bay windownon electric cubicle characteristics whitethorn enable the victimisation of new and improve genus Cancer therapies. Stem carrell stain style open fire be investigated by QPCR and this sensitive method acting has been applyd to characte vacate prostate gland gland crabby person base cubiclephones.MethodsProstate crab louse cell lines LNCaP and C42B were grown under partisan and non aid agriculture conditions. Non- backer culture agentrated prosta sphere of influences that be enriched in foot cells. In addition, LNCaP and C42B prostaspheres were treat with Wnt3a. ribonucleic acid was extracted from both ally and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was per stocked with TaqMan probes in modulate to examine the style of 10 components Nestin, Oct4, Sca-1, BMI-1, PSA, N SE,CD44, K18, ABCG2 and c-kit.ResultsProstasphere culture get tod a dramatic ontogenesis in the relative expression of ABCG2 and Keratin 18 in both cell types.ConclusionThe findings suggest ABCG2 may be a rich scrape for realisation of prostate crab louse cells with tooth root cell characteristics. notwithstanding this technique of Q-PCR may prove to be a sensitive method of evaluating markers in malignant neoplastic disease patients.IntroductionProstate crabby person is commsolely diagnosed in males oer 60 and is the second more or less common cause of genus Cancer death in UK in men, after lung crab louse (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and juicy risk. For low risk cases treatment is usuall(a)y under active watch while intermediate and high risk is tough by surgical procedure and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost ceaselessly produces objective clinical responses (2). but, in most patients there is relapse with the accession of androgen independent prostate cancer, which is associated with a median survival, of 2024 months (3). Currently, androgen independent metastatic prostate cancer is set by Docetaxel an anti-mitotic that extends life by an average of 3 months (3).Although, the mechanisms of prostate cancer development and feeler piddle been extensively studied this process is not to the full understood. Several genes including MYC and PTEN train been linked to the development of prostate cancer (28). However, integrity of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that fig outs as a topic of a genetic translocation (4). TMPRSS2 is androgen-regulated transtissue layer serine proteases secreted by figure prostatic tissue and an increase in androgen level increases TMPRSS2 expression.ETS family transcription factor (ERG, ETV1, or ETV4 ) takes genes involved in cell transformation, reaping and apoptosis. hence fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins sire been speculated to play a spot in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen sensory receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer chemical group cells.Recent publishers have conceptualized that cancer can arise from cancer cells with the characteristics of arrest cells, un exceptional ego-importance- successor and the ability to produce severalize young lady cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient s urvival. The cancer stem cell model surmisal is that cells with stem cell characteristics accumulate genetic transfers over long period of time, escape the environmental carry and give rise to cancerous growth. thither is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to unassailable tumour development in brain, knocker, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations perchance puzzle in a tumour (5).On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen want or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identify mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour m etastasis.For this reason it is vital to understand the stages of cell specialisation in normal prostate epithelium and identification of cells that argon involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). apiece prostatic duct is lined by nonsecretory basal cells which form a layer on the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal still components and lining the lumen of duct and acini. These phenobarbital cells are highly differentiated and expresses prostate peculiar(prenominal) antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27).Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland.Figure 1. Schematic debut of the cell types inside a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000)Recent evidence has suggested stem cells are also present at heart the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A cursory amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and change magnitude expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and drawed there is 2-3 spate increases in expression of surface level of integrin 21.Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer ( De Marzo MA et al 1998).De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate primogenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into get along with secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009).Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when re turned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18).English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells scuppered regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells take within the basal layer of the gland and are able to fit in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer.At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. component expression and microarray profiling may be able to identify specific markers. These markers may also be prediction for patient response to therapy and survival. former(prenominal) papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostasphere s, which may be referable to different percentages of stem cells within the cell lines or peradventure tie in to adaptation to their environment in the nonadherent culture conditions.Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). sendQuantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, three-figure PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture.Material and MethodsFor my project I use the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation ( P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23).I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and earmarked me to compare the RNA gene expression in relation to the bidding (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to impose how this affects the gene expression of the mRNAs.Cell CultureProstate cancer cell lines LNCaP, C42B and DU145 were courteous at 37C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 g/ml) (Invitrogen). Trypsin (Sigma-Aldr ich) was utilize to detach adherent cells, prior to cell counting, transit or analysis (10). Prostasphere cultures were established on low attachment 6-well collection plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were disposed(p) for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20g/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis.RNA ExtractionRNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70C and thawed at 37c before extraction) using RNeasy kit up (Superscript II enzyme and Poly-A solid ground) from Qiagen. 600l of RLT Plus (10l of -mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was ad ded to the cells. The lysate was accordingly added to the QIAshredder keel mainstay sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g).The flow by dint of was transferred to another tubing and an equal meretriciousness of 70% ethanol was added and meld by pipetting several times. 700l of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700 l of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection thermionic valve-shaped structure. 500 l of buffer RPE was added to the column and centrifuged for 2 minutes to ironical the RNeasy membrane.To provided dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30 l of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80C freezer (detailed protocol attached in Appendix).Reverse transcriptionc-DNA tax deduction was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. accord to the manufacturers instruction 2 l (2 g) of previously prepared RNA was added to 1l of 50uM oligo (dT)20, 1l of 10mM dNTP mix in a tube and DEPC- toughened water added to make a volume of 10 l. The answer tube was incubated at 65C for 5 mins and then placed on ice for one min. In another tube 2 l of 10X RT buffer, 4l of 25mM Mgcl2, 2 l of 0.1DTT, 1 l of RNaseOUTTM (40U/ l) and 1 l of SuperScriptTM III RT (200 U/ l) was added. The 10 l mix of the first tube was added to the second tube and incubated for 50 mins at 50C. The reaction was terminated by incubating at 85C for 5mins and then chilled on ice. 1 l of RNase H was added to t he tube and incubated for 20 mins at 37C. The total yield of cDNA was 25 l and this was stored at -20C till further use.Polymerase Chain reactionPolymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* earth GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For individually reaction 5 l of 10xPCR buffer II, 3 or 6 l of 25mM MgCl2, 4 l of 10mM dNTP, 1 l of forward and reverse primer at 10 M and 0.25 l of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/l was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94C for 6 min, and then 35 cycles of 94C for 30 secs, 55C for 30 secs, 68C for 30 secs, 72C for 30 secs followed by 72C for 6 mins. jelly ElectrophoresisIn order to look on the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent fixture tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. intercourse Quantitative PCRIn real-time quantification technology the TaqMan MGB probes contain A newsperson discolour (6-FAM) linked to the 5 end of the probe. A minor distribution channel binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997 Kutyavin et al., 1997) it also allow the design of unretentiveer probes.A nonfluorescent quencher (NFQ) at the 3 end of the probe 5 Nuclease Assay ProcessA TaqMan probe contains a reporter dye at the 5 end and a quencher dye at the 3 end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26).Figure 3.TaqMan probes require a equalize of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and genera tes a fluorescent signal (Invitrogen).The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals amid the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26).For quantification of the transmit in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10 l of final volume of TaqMan mix was placed. The mixture included 5l of TaqMan Gene preparation Assay, 0.5 l of the primer, 0.5 l of GAPDH ( endogenetic Control) and 4 l of 13 weaken samples. Prior to this study Ct value (cycle threshold) with a ideal wrick (Fig 5) was constructed and the primer and GAPDH concentration wer e determined by optimisation studies. All the primers were purchased from use biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50C for 2 min, followed by 95C for 10 mins. Then 40 cycles of 95C for 15 secs and 60C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the Ct method using GAPDH as endogenous control.Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templets have amplified along with GAPDH as endogenous control (figure 5).DATA AnalysisThe data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of step curves several cDNA cell lines were used cDNA from DU145, LNCaP and C42B. The slope of the old-hat curve was calculated from the log insert of cDNA in ng/l versus the corresponding Ct value. Basic statistical analysis was performed in Excel.ResultsCell CultureDr Prowse used a non adherent technique hiatus culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A.Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a stately representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009).RNA extraction and RTPCRUpon RNA extraction of the cells lines and prostospheres the concentrations were metrical by spectrophotometer. It was 234ng/l for C42B and 190ng/l for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5).Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and passageways 6-10 contained 3mM Mg++.(B) A 2% gel was run with the PCR products that were amplified in received date PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The ii bands represented GAPDH and the gene of interest.For construction of a standard curve, serial dilutions (1ng/ l, 5ng/l, 20ng/ l and 50ng/ l) of cDNA were used. In all cases, there was a strong linear correlativity between the number of thermal cycles required to generate a satisfying fluorescent signal above background and the log of the input cDNA amount (correlation coefficient 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis.Figure 6. Real time RT-PCR standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/l, 5 l, 20 l and 50 l . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained.Quantification and Comparison of the Real Time Quantitative RTPCRresults between Adherent cells un toughened Prostasphere and handle Prostasphere.Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control.In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8).The PCR products were decide on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes.The method of computer science was by Ct method. This method calculates the crease change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line.Each of the samples were run in triplicates, therefore an average of those three were interpreted in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/ 3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated.Table 2. Example of calculation for quantification of gene expression in fold changes.SampleAverage Ct a of samples bAverage Ct of GAPDHCtCtRQ set dProstasphere30.1318.9411.19-2.014.04Prostasphere +Wnt3a31.2019.7511.46-1.743.34Prostasphere control33.9722.711.27-1.933.82Prostasphere+ cyclopamine30.2819.4310.9-2.355.09Adherent Cells c13.2001a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the Ct value was calculated from the standard curve. d. Relative quantification or fold changes.Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19.Fold changes are calculated relative to the adherent cells. Therefore Ct is calcu lated by subtracting the Ct value of the adherent cells from the Ct of the sample i.e.11.19-13.20=-2.01.Relative quantification (RQ) value of gene expression was calculated by the use of the equationRQ= 2-CtRQ=2-(-2.01)Therefore an RQ or fold change relative to the adherent cells is 4.04.Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the Ct method.(A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant.(B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed.(C) The prostasphere show nearly twain fold increase in expression.(D) Oct4 uttered about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine).(E) In LNCaP Oct4 expression is reduce in Wnt 3a treated prostasphere.(F) In C42B pros tasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression.(G) However this change is not as pronounced in LNCaP.(H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine.(I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere.(J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine.(L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction.(N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker.(P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed minify levels.(Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere.(R) c-kit/CD117 was expressed more in the prosta sphere with reduced expression on the Wnt3a treated and cyclopamine treated samples.Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R).NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and one C% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q).In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE , 100% in case of Keratin 18 (Figure 7 C, G, I, and K).A abstract of the results are shown in table 3.Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR).DiscussionCollins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are accountable for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products.Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40).Prostate cancer is a mixed disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultu red by Dr Prowse.Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, 21 integrin, Sca-1 and -catenin and PSA can be use to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human.Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the campaign force behind proliferation and differentiation of the transit amplifying cell. -catenin which is also an effector of WNT signboard can interact with the activity of AR (Bisson and Prowse et al 2009).In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the proportion of WNT and AR activity not o nly regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells.In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation.Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in giving tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a ). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, reappearance quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate in short characteristics of stem cells.In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease.Neuroendocrine cells provide growth and survival signals to touch tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-run androgen ablation the rapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture.A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher(prenominal) level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population.Evidences have been provided that show CD44 to be present in tumourinitiating cells (36, 37). Therefore it is probable the CD44 would exhibit high exp